شماره ركورد كنفرانس
3693
عنوان مقاله
In Silico Cancer Therapy by Using Genome Editing Tool: CRISPR/Cas9
پديدآورندگان
Mosazadeh Marziyeh m.mosazadeh@modares.ac.ir Biology department, Tarbiat Modares University , Rezaee Zahra Biology department, Isfahan University
تعداد صفحه
10
كليدواژه
CRISPR , Cas9 , Cancer , Telomerase , Crispor
سال انتشار
1396
عنوان كنفرانس
اولين كنگره بين المللي زيست پزشكي ICB2017
زبان مدرك
انگليسي
چكيده فارسي
Introduction and purposes: Given the fact that cancer today has a broad spectrum of diseases in the populations, and also by relying on the fact that most cancers are the results of mutations in more than one locus in genomes, finding a quick and reliable way that can respond curing more cancers without damaging healthy tissues in the body, and also the way which has the minimum side effects is important and essential. Therefore, in this research, the knocking out method on telomerase gene, which is active in 80-90% of cancers, has been studied. Although different methods have been proposed to silence this gene or its protein, like: direct enzyme inhibition via allosteric inhibitors, telomerase immunotherapy, blocking telomerase expression, and suicide gene therapy; but the use of CRISPR/Cas9 as a gene editing tool can be a quick way, more accurate and less costly.
Materials and methods: First, the NCBI (https://www.ncbi.nlm.nih.gov) was checked and complete telomerase sequence, as well as the sequence of its promoter, was identified with the part of the cdc sequence. Then, considering that for eliminating a sequence two gRNAs should be designed, one at the 5 end and the other at the 3 end of the desirable sequence, a broad regions in TERT promoter which has 1665 bp length was selected and the appropriate PAM for cutting, was investigated by the crispor site (http://crispor.tefor.net). Then the 5 and 3 gRNAs were designed with the least off target and maximum efficiency.
Results: At the 5 region upstream of the removal site, 15 PAMs were found with highest specificity, of which the PAM in ‘81 rev’ site was selected. At the 3 end of cutting region, there were about 32 PAMs with highest specificity that ‘159 fw’ took the most appropriate score. Thus, the designed gRNAs to remove part of the promoter of the telomerase gene were:
5 gRNA: CATGGCGAGGAAACGCCTCC CGG
3 gRNA: GCTGCGCAGCCACTACCGCG AGG
Note that the selected PAM was NGG.
Conclusions: In accordance with the explained analysis, it seems that knocking out TERT- gene in tumors by eliminating the promoter of this gene by CRISPR system is effective and accurate in treating more than 80-90% of cancers. It can be noted that molecular analysis and in vitro methods, as well as clinical studies, are needed to approve this issue.
كشور
ايران
لينک به اين مدرک