شماره ركورد
1049628
عنوان مقاله
خاموشي ژن سم زداي CYP6CM1 در سفيدبالك پنبه .Gennadius Bemisia tabaci با استفاده از تكنيك RNAi
عنوان به زبان ديگر
Silencing of CYP6CM1 gene of cotton whitefly Bemisia tabaci (Gennadius) using RNAi technique
پديد آورندگان
بسيج، مسلم دانشگاه جيرفت - گروهگياهپزشكي - دانشكدهكشاورزيومنابعطبيعي , طالبي، خليل دانشگاه تهران - گروهگياهپزشكي - دانشكدهكشاورزيومنابعطبيعي , حسيني نوه، وحيد دانشگاه تهران- گروهگياهپزشكي- دانشكدهكشاورزيومنابعطبيعي , سلامي، عليرضا دانشگاه تهران -گروهبيوتكنولوژي
تعداد صفحه
11
از صفحه
79
تا صفحه
89
كليدواژه
Bemisia tabaci , ايميداكلوپريد , مقاومت به حشرهكشها , خاموشي ژن
چكيده فارسي
سفيدبالك (Gennadius.)Bemisia tabaci يكي از مهمترين آفات گياهان زراعي و محصولات زينتي در جهان است و مشاهده شده است كه قابليت مقاوم شدن به بسياري از گرو ههاي حشرهكشها را دارد. اين آفت توانايي بروز مقاومت به گروههاي مختلف حشره كش از جمله نئونيكوتونوئيدها را دارا ميباشد.در مطالعه ي حاضر تاثير استفاده از تكنيك خاموشي ژن (RNAi) ژن CYP6CM1 به عنوان يكي از اصليترين ژنهاي مسئول بروز مقاومت به نئونيكوتينوئيدها روي سطح نسبي بيان، اندازه مقاومت و ميزان فعاليت آنزيم سيتوكروم P450 در دو جمعيت سفيدبالك پنبه مقاوم و حساس در برابر حشرهكش ايميداكلوپريد مورد ارزيابي قرار گرفت.كلني جمعيتهاي سفيدبالك پنبه روي برگهاي گياه گوجه و در اتاقك رشد پرورش يافت. RNA دو رشتهاي ژن CYP6CM1 با استفاده از پرايمرهاي اختصاصي سنتز شد و آزمايشات زيستسنجي پس از وارد كردن dsRNA به داخل بدن حشره از طرق دريافت دهاني و با محاسبه مقدار LC50 و نسبت مقاومت با استفاده از نرم افزار كامپيوتري Ploplus انجام شد. اندازهگيري فعاليت مونواكسيژناز نيز با استفاده از زير نهشت 7- اتوكسي كومارين انجام شد. آناليز دادهها نشان داد كه تغذيه دهانيdsRNA به طور موثري ميزان سطح بيان نسبي ژن CYP6CM1 (2 برابري)، اندازه مقاومت (3/5 برابري) و ميزان فعاليت آنزيم سيتوكرومP450 (45 درصدي) را در جمعيت مقاوم تغذيهشده باCYP6CM1dsRNA كاهش داد. كاهش چند برابري اندازه مقاومت بيانگر امكان استفاده عملي از تكنيكRNAi در مديريت مقاومت B. tabaci ميباشد
چكيده لاتين
Background and Objectives
The cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a significant agricultural pest in arable lands and on ornamental crops in temperate regions of the world and has been shown to be capable of developing resistance to many classes of insecticides. Difficulties in controlling B. tabaci mainly result from its resistance to insecticides, including neonicotinoids. Neonicotinoids are a relatively new class of synthetic insecticides used primarily to control of whiteflies, B. tabaci is capable of developing resistance to different classes of insecticides as neonicotinoides. It has been experimentally proven that resistance of B. tabaci to imidacloprid is associated with overexpression of the P450 genes. RNA interference (RNAi) has been successfully applied in insects to study RNAi mechanisms and gene functions. In this study, the RNA interference (RNAi) effects of P450 CYP6CM1 as key gene in resistance to neonicotinoides on expression, resistance ratio and total P450 activities were evaluated.
Material and Methods
Colony of whitefly reared on leaves of tomato plants in growth chamber at 25 ± 2 ºC, 65±5% RH and a photoperiod 16:8 h (light: darkness). Total RNA was isolated from adult B. tabaci using Biosol reagent (Invitrogen). cDNA synthesis was performed using iScript cDNA Synthesis Kit (BIO-RAD). Double-stranded RNA (dsRNA) of P450 CYP6CM1 was synthesized using specific primers (3' TAATACGACTCACTATAGGG 5', 3' TAATACGACTCACTATAGGG 5'), the bioassay tests after introduce of dsRNA into the insect body of whitefly by oral delivery were carried out for 6 days, and mortality was recorded daily by counting the dead insects at the bottom of the tube. The LC50 and resistance ratio were calculated using Ploplus computer software. The amount of cytochrome P450 activity was measured using 7-ethoxycoumarin based on the microfluorimetric method. Quantification of mRNA expression levels was quantified using the comparative cross-threshold (CT) (the PCR cycle number that crosses the signal threshold) method.
Results
Analysis of knockdown effects of CYP6CM1 on resistance was based on probit analysis and indicates that the gene is responsible for up to 5.3-fold reduction in imidacloprid resistance of dsRNA-fed adults. Moderate, but significant reduction in total P450 activity (45 %) exhibited by microsomal proteins prepared from dsRNA-fed JR population adult when compared to the control (JR population without dsRNA-fed). The results of P450 CYP6CM1 mRNA expression levels showed decrease in mRNA levels of the target genes with increasing the time after feeding dsRNA. Results revealed that delivery dsRNA to adult insect's reduced CYP6CM1 expression up to 2 -fold when comparing to the control.
Discussion
Reduction in resistance ratio by 5.3 fold after CYP6CM1 dsRNA fed in resistance population indicated the possibility of practical use of RNAi technique in insect resistance management (IRM).
سال انتشار
1398
عنوان نشريه
گياه پزشكي(دانشگاه شهيد چمران اهواز)
فايل PDF
7576372
عنوان نشريه
گياه پزشكي(دانشگاه شهيد چمران اهواز)
لينک به اين مدرک