• شماره ركورد
    1270873
  • عنوان مقاله

    پراكنش و تحليل تبارزايي ويروس برگ بادبزني مو در باغات انگور استان خراسان رضوي بر‌اساس پروتئين پوششي

  • عنوان به زبان ديگر
    Distribution and Phylogeny of Grapevine fanleaf virus in Vineyards of Khorasan Razavi Province Based on Coat Protein Region
  • پديد آورندگان

    قاروني كارداني، سارا سازمان تحقيقات، آموزش و ترويج كشاورزي - مركز تحقيقات و آموزش كشاورزي و منابع طبيعي استان خراسان رضوي - بخش تحقيقات گياه‌پزشكي، مشهد، ايران , كريمي شهري، محمود رضا سازمان تحقيقات، آموزش و ترويج كشاورزي - مركز تحقيقات و آموزش كشاورزي و منابع طبيعي استان خراسان رضوي - بخش تحقيقات گياه‌پزشكي، مشهد، ايران , آزاد ديسفاني، فاطمه سازمان تحقيقات، آموزش و ترويج كشاورزي - مركز تحقيقات و آموزش كشاورزي و منابع طبيعي استان خراسان رضوي - بخش تحقيقات گياه‌پزشكي، مشهد، ايران

  • تعداد صفحه
    11
  • از صفحه
    421
  • از صفحه (ادامه)
    0
  • تا صفحه
    431
  • تا صفحه(ادامه)
    0
  • كليدواژه
    پراكنش , تبارزائي , خراسان رضوي , ويروس برگ بادبزني مو
  • چكيده فارسي
    ويروس برگ باد بزني مو (Grapevine fanleaf virus, GFLV) در تاكستان‌هاي مناطق مختلف دنيا شيوع دارد. علائم ايجاد شده توسط اين ويروس اغلب در سه گروه برگ بادبزني، موزاييك زرد و رگبرگ نواري تقسيم‌بندي شده‌اند كه علت تفاوت در ايجاد علائم، به تنوع ژنتيكي جدايه‌ها نسبت داده شده است. شدت علائم ايجاد شده به جدايه‌ي ويروس، حساسيت رقم مو و شرايط محيطي بستگي دارد. در اين تحقيق پراكنش و تحليل تبارزايي ناحيه كدكننده پروتئين پوششي ويروس بررسي شد. نمونه‌ها از تاكستان‌هاي‌ استان خراسان رضوي جمع‌آوري و ژن پروتئين پوششي از پنج جدايه تكثير، همسانه‌سازي و تعيين ترادف گرديد. به اين منظور، تعداد 109 نمونه برگ داراي علائم‌ از تاكستان‌ها جمع‌آوري و در آزمون الايزا با استفاده از آنتي‌بادي اختصاصي GFLV آلودگي به ويروس در 58 نمونه تأييد شد. بيشترين ميزان آلودگي در بين نمونه‌هاي جمع‌آوري شده از منطقه محمديه واقع در شهرستان كاشمر بود. با استفاده از آغازگرهاي اختصاصي قطعه‌اي بطول 1760 جفت باز مربوط به طول كامل ناحيه كد‌كننده پروتئين پوششي ويروس و قسمتي از انتهاي'3 ژنوم تكثير شد. پروتئين پوششي جدايه‌هاي انتخاب شده در سطح نوكلئوتيدي و آمينواسيدي به‌ترتيب 94-90 و 97-91 درصد با جدايه‌هاي ساير نقاط دنيا شباهت داشت. تحليل تبارزائي بر اساس ناحيه كد كننده پروتئين پوششي، جدايه‌هاي ايراني GFLV را در شاخه‌اي مجزا از جدايه‌هاي ساير نقاط دنيا قرار داد. همچنين جدايه‌هاي شمال شرق كشور در گروهي مجزا از جدايه‌هاي شمال غرب كشور قرار گرفتند، كه نشان‌دهنده اثر جدايي جغرافيايي در تكامل GFLV است. نتايج حاصل از اين تحقيق بيانگر بومي بودن GFLV در ايران و گسترش احتمالي آن از اين منطقه به ساير نقاط جهان است.
  • چكيده لاتين
    Introduction: Virus and virus-like diseases cause intensive damage in vineyards all over the world. Grapevine fanleaf virus (GFLV) is one of the most economic important viruses infecting grapevine worldwide. It is a major limiting factor for grapevine productions and reduces fruit quality and shortens the longevity of grapevines in the vineyards. GFLV belongs to the genus Nepovirus in the family Secoviridae and has a bipartite single-stranded positive RNA genome which encapsidated in isometric particles. Both RNA molecules contain a genome-linked viral protein (VPg) at 5' end and a poly (A) tail at 3' end of genome. GFLV is transmitted naturally from grapevine to grapevine by the ectoparasitic nematode Xiphinema index in the vineyard. Fanleaf disease causes three groups of symptoms, including malformation, vein clearing and yellowing. This difference in symptoms is related to diversity in the genome of the virus because in one cultivar can be seen both groups of symptoms. Khorasan Razavi province has the third largest area under grape cultivation in Iran in this study we studied distribution and diversity of GFLV isolates in vineyards of Khorasan Razavi province. Materials and MethodsPlant material and virus isolates During two consecutive growing seasons of 2019 and 2020, a survey was conducted in some of the major areas under the cultivation of grapevine in Khorasan Razavi (Kashmar, Khalilabad, Mohammadiyeh Bardaskan, Neyshabour) at the northeast of Iran. A total of 109 grapevines samples were collected and tested for GFLV infection by enzyme-linked immunosorbent assay (ELISA) as described by Clark and Adams (1977). Total RNA was extracted from petioles of ELISA positive samples using CTAB-PVPP method and were used directly or stored at - 70 0C. Reverse transcriptase –PCR, cloning and sequencing cDNA was synthesized by Thermoresistant MMuLV reverse transcriptase (Parstous, Iran) according to the manufacturer's protocol. RT-PCR using specific primer pairs MpF (5'- AGAAGTCGCTCACGATCTGTGAGG -3') and CpR (5'- ACAAACAACACACTGTCGCC- 3') was amplified 1760 bp fragment corresponding to the complete length of coat protein and 230 nucleotides of 3' proximal end in order to detect infected samples. The RT-PCR products were electrophoresed on 1% agarose gel, stained with Green viewer (Pars tous, IRAN), and visualized by UV light. The gel extracted PCR products were cloned into, pTG19-T PCR Cloning Vector, (Vivantis, Malaysia) following the manufacturer’s instructions and were transformed to Escherichia coli strain DH5α. Then colony-PCR using M13 and the specific primer pairs were used to confirm the recombinant clones. Random recombinant clones were selected to extract plasmid DNA using a Qiagen Plasmid Miniprep Kit (Qiagen, Germany). Finally, The GFLV coat protein gene has been sequenced in both directions. Results and Discussion: In this study, 109 samples of symptomatic vines were collected from the vineyards of Khorasan Razavi province. 58 samples were confirmed to be infected using indirect ELISA and reverse transcriptase polymerase chain reaction tests. The most symptoms in vineyards were vein banding, leaf malformation, open petiolar sinus, stunting and bushy growth of shoot, zigzagged shoot and double nodes in infected stem. The prevalence of this virus was high in the samples of Mohammadiyeh region. cDAN fragment of GFLV genome with 1760 bp in length corresponding to the GFLV coat protein gene was amplified with specific primers. Full-length sequences of the coat protein gene were recorded in the GenBank. Nucleotide sequence identities of 90-94% were found between the coat protein region of isolates of this study and that of deposited in the GenBank previously. Phylogenetic analysis carried out on the GFLV-CP gene of 5 Iranian GFLV sequences selected in this study showed that GFLV isolates of Iran and the world in the phylogenetic tree were divided into two main groups. Conclusion: The virus has been detected in northwestern, northeastern and southern vineyards in Iran. Probably GFLV originated in Iran, so widespread spread of the virus in these areas is possible. The propagation of infected cuttings has played a major role in the spread of the virus in vineyards. The capsid protein gene is a conserved region and be used in the molecular phylogenetic analysis and it is the sole viral determinant of the specific transmission of GFLV by its vector. Phylogenetic analysis carried out on the GFLV-CP showed that GFLV isolates were separated into two statistically significant clusters: the first one (I) including isolates from Iran, and the second one (II) including isolates from different countries, and Iranian isolates of GFLV have distinct position in phylogentic tree. Furthermore, evidence of divergent evolution was observed between isolates from northwest, northeast and south of Iran. It confirms that genetic makeup of GFLV may be affected by geographical isolation. The percentage of GFLV infected samples in summer was much lower than the samples detected in mid-spring. The results of previous research also indicated that GFLV titer in the grapevines drops during the summer hot season. High genetic diversity has been observed in coat proteins gene, this change may be due to an error in the RNA-dependent RNA polymerase (RdRp) enzyme during amplification or due to recombination events. Geographical area among them has a positive effect on evolution and phylogenetic relationships.
  • سال انتشار
    1400
  • عنوان نشريه
    پژوهش هاي حفاظت گياهان ايران
  • فايل PDF
    8589387