• Title of article

    Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences

  • Author/Authors

    Motalleb، Gholamreza نويسنده ,

  • Issue Information
    فصلنامه با شماره پیاپی 9 سال 2014
  • Pages
    8
  • From page
    43
  • To page
    50
  • Abstract
    Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090 > 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846 > 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism’s transcriptome is related to its cellular proteome.
  • Journal title
    International Journal of Molecular and Cellular Medicine(IJMCM)
  • Serial Year
    2014
  • Journal title
    International Journal of Molecular and Cellular Medicine(IJMCM)
  • Record number

    1024110