Identification of a Transcription Factor That Binds to the Promoter Region of the Human Parathyroid Hormone Gene

A putative transcription factor binds a site adjacent to the negative vitamin D responsive element (VDRE) in the promoter region of the human parathyroid hormone gene. Deletion and mutation analysis reveal the binding site for this factor overlaps with the proximal repeat element of the VDRE. It includes additional nucleotides at the 3′ end of the VDRE. This site has the sequence TTTGAACCTATAGTTGAGAT and a core sequence TGAACCTAT needed for binding of the factor. Experiments with specific anti-vitamin D receptor (VDR) antibodies demonstrate that VDR is not found in the factor/DNA complex. However, removing the VDR from the nuclear extract by immunoprecipitation eliminated the binding complex, and the addition of recombinant VDR to the depleted extract did not restore the factorʹs ability to bind to the DNA, suggesting that the factor and VDR are closely associated. Transfection experiments with various reporter constructs indicate that the factor is required for the high transcriptional activity of the human PTH gene. This high activity is significantly suppressed by 1,25-dihydroxyvitamin D3. This factor seems to be expressed in several cell types including rat osteoblasts and pituitary. Additionally, some human cancer cell lines express a high level of this factor.