First Case of Imported Plasmodium Ovale from Iran

Malaria is one of the most important vector-borne parasitic diseases in the world, particularly in tropical and subtropical areas.1,2 It is caused by one, or rarely more than one, of four plasmodia species namely, Plasmodium vivax, P. falciparum, P. malariae and P. ovale. Plasmodium ovale has a pattern of fever and relapse similar to that of P. vivax, but generally milder clinical symptoms,3 Plasmodium ovale is mostly limited to tropical Africa and Southeast Asia,4-6 with a prevalence of 10-15% and 2.0-9.4%, respectively.7 Iran is an endemic region for malaria in the Middle East with P. vivax, P. falciparum, and rarely P. malariae infections. Herein the first authentic imported case of Plasmodium oval in Iran is reported. A twenty years old Nigerian soccer player was referred to a Health Centre in Bandar Abbas, Iran with fever (38.5°C) chills, anorexia and bone pain. The patient had arrived in Iran, and resided in Bandar Abbas one month before the onset of clinical symptoms. The vital signs were within normal range and the laboratory analysis of his blood showed, a platelet count of 136000. His abdomen was soft without organomegaly and his urine analysis was also normal. The patient stated that he had a history of malaria almost the year before in Nigeria, and had been treated. However, he could not remember the type of malaria and the treatment he received. Standard Giemsa–stained thick and thin blood smears from finger-pricked blood samples were made, and microscopically examined. Typical trophozaites of P. ovale were detected. In thin films, many erythrocytes were slightly enlarged assuming an oval shape with ragged margins and heavy stippling. To further characterize the parasite genus, a molecular genomic sequencing technique was employed. Blood samples scratched from non-stained smears were used to extract the total genomic DNA using Qiagen kit (QIAamp DAN Blood).8 The fragments of 18 ssrRNA with a band of 787 bp was amplified using PLF (Forward; 5’: agtgtatatcaatcgagttte 3’) and UNR (Reverse; gacggtatctgatggtettc) primers,9 (figure 1). The amplified product in unit 700 bp was sequenced at SEQLAB, Germany (Germany; http://www.seqsondemand.de) to confirm the species of Plasmodium ovale. Nucleotide sequence data were registered in the GenBank database with the accession no. GQ397481. The patient received standard treatment with 1 g chloroquine phosphate (600 mg base) orally for two days followed by 500 mg chloroquine phosphate (300 mg base) on the third day. (Chloroquine tablets were 250 mg with 150 mg base). Administered dosage was 10 mg/kg on first and second day of treatment and 5 mg/kg on the third day. Primaquine was administered to prevent relapse with a dosage of 45 mg weekly (0.75 mg/kg/week) for 8 weeks (Primaquine tablets were 26.3 mg with 15 mg base). All people in near contact with the patient were examined for likely malaria infection. The pa-