• شماره ركورد كنفرانس
    4719
  • عنوان مقاله

    Molecular Dynamics Simulation of the Inhibition of HIV-1 Protease by RNA Aptamer: Effect of Mutation

  • پديدآورندگان

    Ajamgard Marzieh m.ajamgard@azaruniv.ac.ir Molecular Simulation laboratory (MSL), Azarbaijan Shahid Madani University, Tabriz, Iran; E-mail: , Jahanbin sardroodi Jaber Molecular Simulation laboratory (MSL), Azarbaijan Shahid Madani University, Tabriz, Iran , Rastkar Ebrahimzadehc Alireza Molecular Simulation laboratory (MSL), Azarbaijan Shahid Madani University, Tabriz, Iran

  • تعداد صفحه
    1
  • كليدواژه
    HIV , Protease Inhibit , Molecular Dynamics , RNA Aptamer.
  • سال انتشار
    1397
  • عنوان كنفرانس
    بيست و يكمين كنفرانس ملي شيمي فيزيك انجمن شيمي ايران
  • زبان مدرك
    انگليسي
  • چكيده فارسي
    The human immunodeficiency virus tpe-1 (HIV-1), a member of retrovirus family, has been a causative organism in an acquired immunodeficiency syndrome (AIDS). One of the important enzymes necessary for the replication of this virus is HIV-1 protease (HIV-1 PR). Thus, searching for HIV-1 PR inhibitors from natural sources has become a promising approach [1]. HIV-1 aspartyl protease (PR) plays a key role in virion morphogenesis, underscoring the effectiveness of protease inhibitors (PI) [2]. In the present study, we studied two aptamers with nucleotid sequencing of CCGGGTCGTCCCCTACGGGGACCTAAAGACTGTGTCCAACCGCCCTCGCCT named as AP1 and AP2 with nucleotid sequencing of CTTCATTGTAACTTCTCATAATTTCCCGAGGCTTTTACTTTCGGGGTCCT and a mutant structure of it named as AP3. In the mutated aptamer C, T, A, C and C nucleotids of AP2 were substituted with A, G, G, A and T to yield AP3. The considered aptamers have been studied experimentaly by Duclair et al [2] from the stability and HIV-1 protease binding ability aspects. Structures of HIV-1 protease enzyme was taken from Protein Data Bank (http://www.pdb.org/pdb/). Classical molecular dynamics simulations were performed using NAMD package [3], and visual molecular dynamics (VMD) [4] was used for visualization and analysis of the trajectories. The results of the simulation including structural results like RMSD, hydrogen bonds and radial distribution functions as well as energetics of the complex like interaction energy and the contribution of van der Waals and electrostatic interactions in it have been extracted and discussed. The structural results show that the aptamers bind to the active site of considered enzyme and the energetic results show that the aptamers have relatively high affinity to their targets.A further study reveals that there is a direct correlation between the length of RNA aptamer and the strength of aptamer binding to the target. In addition to the above results, we have also described the nature of interaction and binding characterization by the using of the variations in the secondary structures and the distribution of interaction energies. Although the AP1 aptamer was the best inhibitor it was not the species with the highest affnity for HIV-1 PR. The mutant aptamers also exhibited enhanced effcacy in inhibiting the activity of PR compared to the parental sequences. Finally, with due attention to the high effectiveness and the proprietary function of aptamers, we can conclude that these compounds may be considered as effective HIV-1 antiprotease drugs.
  • كشور
    ايران